LXL04_026227 | RubberDandelionOmics

Gene overview

LXL04_026227

Reference: OH-1004 Chr: Chr05 Coordinates: 123358023-123360761 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1164 bp · LXL04_026227|LXL04_026227|OH1004|cDNA

ATGCTAAGCCGACGGAGTCCTAAAAGATCCATGGATAGTAAGAACAATGGCAAATGGTACCCCGTTTTGGTTATGGTTGCCGTTCATTTTGTTTTCGCTACTATTAATGTACTCCTCAAAAAGGTTATAGTCGATGGACTCAACCATCTCGTCTTTATTACTTACCGCCTGACTGTCGCCACCATCTTTTTGGCCCCCGTAGCCTTCTTTTTCGAAAGGAAGAGCCAACCGAAGCTCACATACAGCATATTGTTCTTCCT...

CDS

Download CDS FASTA

1164 bp · LXL04_026227|LXL04_026227|OH1004|CDS

ATGCTAAGCCGACGGAGTCCTAAAAGATCCATGGATAGTAAGAACAATGGCAAATGGTACCCCGTTTTGGTTATGGTTGCCGTTCATTTTGTTTTCGCTACTATTAATGTACTCCTCAAAAAGGTTATAGTCGATGGACTCAACCATCTCGTCTTTATTACTTACCGCCTGACTGTCGCCACCATCTTTTTGGCCCCCGTAGCCTTCTTTTTCGAAAGGAAGAGCCAACCGAAGCTCACATACAGCATATTGTTCTTCCT...

Protein

Download Protein FASTA

387 aa · LXL04_026227|LXL04_026227|OH1004|PROTEIN

MLSRRSPKRSMDSKNNGKWYPVLVMVAVHFVFATINVLLKKVIVDGLNHLVFITYRLTVATIFLAPVAFFFERKSQPKLTYSILFFLFVNAILGASLTQYLFLLGLQYTSATFTCAFLNMVPVITFFISLPFGLESVKIKSNAGKAKVIGTIVCLGGGMLLTLYKGMPLFNHHSHLQLETTTATASIHTQSITRLSSLLATRKARWASGSLSLIAGTVLWSSWFLVQSNIGKRYPFQYSSTAIMMFFGAIQSFALSLSVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026227`
TK1151 ID	TkA06G019520
OH-1004 ID	LXL04_026227
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 97.416 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026227

Location Chr05:123358023-123360761 (-)

Description Similar to At3g30340: WAT1-related protein At3g30340

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g30340`	WAT1-related protein At3g30340.	No verified direct reference in this release
`At4g01440`	WAT1-related protein At4g01440.	No verified direct reference in this release
`At1g01070`	WAT1-related protein At1g01070.	No verified direct reference in this release
`At4g01430`	WAT1-related protein At4g01430.	No verified direct reference in this release
`At4g01450`	WAT1-related protein At4g01450.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026227 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0048316 seed development Biological Process

GO:1901349 glucosinolate transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015186 L-glutamine transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

GO:0141165 glucosinolate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G01070

ath:AT3G30340

ath:AT4G01430

ath:AT4G01440

ath:AT4G01450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.470

Rank 1 · LXL04_026227 · OH-1004

Lysosome / Vacuole0.227

Rank 2 · LXL04_026227 · OH-1004

Endoplasmic reticulum0.183

Rank 3 · LXL04_026227 · OH-1004

Golgi apparatus0.069

Rank 4 · LXL04_026227 · OH-1004

Cytoplasm0.065

Rank 5 · LXL04_026227 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00892.27EamA22-160 aa

PF00892.27EamA208-346 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026227	`PF00892.27`	EamA	22	160	2.7e-26	93.2
LXL04_026227	`PF00892.27`	EamA	208	346	2.7e-26	93.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LI65`	Arabidopsis thaliana	WAT1-related protein At3g30340	48.179%	Swiss-Prot	moderate database homology
`Q9M130`	Arabidopsis thaliana	WAT1-related protein At4g01440	46.552%	Swiss-Prot	moderate database homology
`Q5XEZ0`	Arabidopsis thaliana	WAT1-related protein At1g01070	41.734%	Swiss-Prot	moderate database homology
`Q9M131`	Arabidopsis thaliana	WAT1-related protein At4g01430	39.623%	Swiss-Prot	moderate database homology
`Q9M129`	Arabidopsis thaliana	WAT1-related protein At4g01450	44.638%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card