LXL04_025305 | RubberDandelionOmics

Gene overview

LXL04_025305

Reference: OH-1004 Chr: Chr05 Coordinates: 109496558-109499475 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1962 bp · LXL04_025305|LXL04_025305|OH1004|cDNA

ATGGCAGAATCCTCGAATCGGAGGGCGAAAGTGAAAAACAAATCGCCGGCGGAGCAGAACGGTGGAGAAATGAGTCTCGATAAACTCTCGTCGGAAGTCTTCGCCACAATAATGACGAAACTTGATGTTTCTTCGATCTGCGCCATCTCCCTGACTTGCAAAAGCTTTCGCGTTTGCGCTCAAGATATCTTCAAATTTCTCCCAAATTTCCACCTCCTGGAAATCGCAGCTCCAATTGATCGGTTACGAGGATTGTTGCT...

CDS

Download CDS FASTA

1962 bp · LXL04_025305|LXL04_025305|OH1004|CDS

ATGGCAGAATCCTCGAATCGGAGGGCGAAAGTGAAAAACAAATCGCCGGCGGAGCAGAACGGTGGAGAAATGAGTCTCGATAAACTCTCGTCGGAAGTCTTCGCCACAATAATGACGAAACTTGATGTTTCTTCGATCTGCGCCATCTCCCTGACTTGCAAAAGCTTTCGCGTTTGCGCTCAAGATATCTTCAAATTTCTCCCAAATTTCCACCTCCTGGAAATCGCAGCTCCAATTGATCGGTTACGAGGATTGTTGCT...

Protein

Download Protein FASTA

653 aa · LXL04_025305|LXL04_025305|OH1004|PROTEIN

MAESSNRRAKVKNKSPAEQNGGEMSLDKLSSEVFATIMTKLDVSSICAISLTCKSFRVCAQDIFKFLPNFHLLEIAAPIDRLRGLLLPNASLRSLKLDCRRLNESSTDYLLQPGLLELSLRNCFKFSGKLLSEVGARCKHLRSLYVSSVADNRGHLHDVCDLEELFKGCTQLEELILMFDVSIFRRPDFARVWTLASTKLTYLQLGYITQLMVTELLTPTPPPHQQPPHLPPPIFPNLHKLSLSVDYISNTMINIISSTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025305`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025305

Location Chr05:109496558-109499475 (+)

Description Similar to FBL10: F-box/LRR-repeat protein 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g17020`	F-box/LRR-repeat protein 10.	No verified direct reference in this release
`At1g55590`	F-box protein At-B.	No verified direct reference in this release
`At4g15475`	F-box/LRR-repeat protein 4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025305 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003341 cilium movement Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0010225 response to UV-C Biological Process

GO:0010824 regulation of centrosome duplication Biological Process

GO:0030317 flagellated sperm motility Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005813 centrosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005930 axoneme Cellular Component

KEGG gene cross-reference

ath:AT1G55590

ath:AT2G17020

ath:AT4G15475

hsa:222235

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.792

Rank 1 · LXL04_025305 · OH-1004

Cytoplasm0.175

Rank 2 · LXL04_025305 · OH-1004

Cell membrane0.041

Rank 3 · LXL04_025305 · OH-1004

Mitochondrion0.038

Rank 4 · LXL04_025305 · OH-1004

Endoplasmic reticulum0.024

Rank 5 · LXL04_025305 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25372.2LRR_FBXL1579-609 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025305	`PF25372.2`	LRR_FBXL15	79	609	1.7e-120	403.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SDA8`	Arabidopsis thaliana	F-box/LRR-repeat protein 10	50.000%	Swiss-Prot	strong database homology
`Q9ZWC6`	Arabidopsis thaliana	F-box protein At-B	33.443%	Swiss-Prot	moderate database homology
`Q9C5D2`	Arabidopsis thaliana	F-box/LRR-repeat protein 4	24.621%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card