LXL04_022687 | RubberDandelionOmics

Gene overview

LXL04_022687

Reference: OH-1004 Chr: Chr05 Coordinates: 4805483-4808438 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1086 bp · LXL04_022687|LXL04_022687|OH1004|cDNA

ATGGCCGGACAAGAAGACATACCAGAAGGGACGATTCGTAATGTATTGGAGCAAGAGAGTTTGAAGTGGGTATTTGTTGGTGGCAAAGGAGGTGTTGGGAAAACTACGTGCAGCTCTATTCTTTCAATCCTTTTGGCTTCTGTTAGATCGTCGGTTCTTATCATCTCAACTGACCCAGCTCATAATCTAAGCGATGCTTTCCAACAAAGATTCACGAAATCTCCTACTTTGGTTAATGGTTTCACCAATTTATATGCTAT...

CDS

Download CDS FASTA

1086 bp · LXL04_022687|LXL04_022687|OH1004|CDS

ATGGCCGGACAAGAAGACATACCAGAAGGGACGATTCGTAATGTATTGGAGCAAGAGAGTTTGAAGTGGGTATTTGTTGGTGGCAAAGGAGGTGTTGGGAAAACTACGTGCAGCTCTATTCTTTCAATCCTTTTGGCTTCTGTTAGATCGTCGGTTCTTATCATCTCAACTGACCCAGCTCATAATCTAAGCGATGCTTTCCAACAAAGATTCACGAAATCTCCTACTTTGGTTAATGGTTTCACCAATTTATATGCTAT...

Protein

Download Protein FASTA

361 aa · LXL04_022687|LXL04_022687|OH1004|PROTEIN

MAGQEDIPEGTIRNVLEQESLKWVFVGGKGGVGKTTCSSILSILLASVRSSVLIISTDPAHNLSDAFQQRFTKSPTLVNGFTNLYAMEVDPTVEPEETGSSDGMESFLSDLANSIPGIDEAMSFAEMLKLVQTMDYSVIVFDTAPTGHTLRLLQFPSTLEKGLNKMMTLKSKFGGLLGQMTRMFGVGEEFGEDAILGKLEGMKEVIEQVNRQFKDPDLTTFVCVCIPEFLSLYETERLVQELTKFEIDTHNIIINQVLFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022687`
TK1151 ID	TkA06G465780
OH-1004 ID	LXL04_022687
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022687

Location Chr05:4805483-4808438 (+)

Description Similar to GET3A: ATPase GET3A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g01910`	ATPase required for the post-translational delivery of tail-anchored (TA) proteins to the endoplasmic reticulum.	Loss of GET pathway orthologs in Arabidopsis thaliana causes root hair growth defects and affects SNARE abundance.2017 · DOI: 10.1073/pnas.1619525114

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022687 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0048767 root hair elongation Biological Process

GO:0071816 tail-anchored membrane protein insertion into ER membrane Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0043529 GET complex Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

aag:5574421

ath:AT1G01910

cci:CC1G_08655

cnb:CNBK0900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.602

Rank 1 · LXL04_022687 · OH-1004

Nucleus0.299

Rank 2 · LXL04_022687 · OH-1004

Golgi apparatus0.182

Rank 3 · LXL04_022687 · OH-1004

Endoplasmic reticulum0.148

Rank 4 · LXL04_022687 · OH-1004

Cell membrane0.072

Rank 5 · LXL04_022687 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02374.22ArsA_ATPase22-315 aa

PF01656.30CbiA24-215 aa

PF13614.13AAA_3128-147 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022687	`PF02374.22`	ArsA_ATPase	22	315	8.1e-104	347.8
LXL04_022687	`PF01656.30`	CbiA	24	215	2.2e-09	38.0
LXL04_022687	`PF13614.13`	AAA_31	28	147	2e-09	38.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q949M9`	Arabidopsis thaliana	ATPase GET3A	79.143%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card