LXL04_022650 | RubberDandelionOmics

Gene overview

LXL04_022650

Reference: OH-1004 Chr: Chr05 Coordinates: 4104519-4107493 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1533 bp · LXL04_022650|LXL04_022650|OH1004|cDNA

atgtTCATCTTCGTTCTTAGGAGTCGAGAAATGTCAAAACACTTATGGCGCACATCAACTGTTTGTTTTTATGCAGGACTGAACATCTTAAGATTTCGTAATAGAAGAGGTGTGAAAATGGGGAAATTACACGATTTAGAAGATATATCTGATCCTGACCTAGAGTCGTCATCACGGATTTCCTCAATGGATCATGATCAATCACCCACAGCGAATTCAACACACAGTCGCAATTCTTTCGCTTACTGTAGAACTAACTC...

CDS

Download CDS FASTA

1533 bp · LXL04_022650|LXL04_022650|OH1004|CDS

ATGTTCATCTTCGTTCTTAGGAGTCGAGAAATGTCAAAACACTTATGGCGCACATCAACTGTTTGTTTTTATGCAGGACTGAACATCTTAAGATTTCGTAATAGAAGAGGTGTGAAAATGGGGAAATTACACGATTTAGAAGATATATCTGATCCTGACCTAGAGTCGTCATCACGGATTTCCTCAATGGATCATGATCAATCACCCACAGCGAATTCAACACACAGTCGCAATTCTTTCGCTTACTGTAGAACTAACTC...

Protein

Download Protein FASTA

510 aa · LXL04_022650|LXL04_022650|OH1004|PROTEIN

MFIFVLRSREMSKHLWRTSTVCFYAGLNILRFRNRRGVKMGKLHDLEDISDPDLESSSRISSMDHDQSPTANSTHSRNSFAYCRTNSETSFSSEQLTDDFTSSSSDRNSPVCWPATGRSPYRPTLSRFGGIKHNHKLDQIPTDLELDMMKERFSKLLLGEDMSGSGKGVSTAVTISNAITNLYVSMFGQHQRLEPLCPDKKMMWKREMTCLLSVCDYIVELMPPMQPLENEASMETMFSRLRSDIDINLPALIKLDALLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022650`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022650

Location Chr05:4104519-4107493 (-)

Description Similar to ROPGEF2: Rop guanine nucleotide exchange factor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g01700`	Guanine-nucleotide exchange factor (GEF) that acts as an activator of Rop (Rho of plants) GTPases by promoting the exchange of GDP for GTP.	No verified direct reference in this release
`At4g00460`	Guanine-nucleotide exchange factor (GEF) that acts as an activator of Rop (Rho of plants) GTPases by promoting the exchange of GDP for GTP.	No verified direct reference in this release
`At2g45890`	Guanine-nucleotide exchange factor (GEF) that acts as an activator of Rop (Rho of plants) GTPases by promoting the exchange of GDP for GTP.	ROPGEF1 and ROPGEF4 are functional regulators of ROP11 GTPase in ABA-mediated stomatal closure in Arabidopsis.2012 · DOI: 10.1016/j.febslet.2012.03.040
`At5g02010`	Guanine-nucleotide exchange factor (GEF) that acts as an activator of Rop (Rho of plants) GTPases by promoting the exchange of GDP for GTP.	RopGEF7 regulates PLETHORA-dependent maintenance of the root stem cell niche in Arabidopsis.2011 · DOI: 10.1105/tpc.111.085514
`At4g38430`	Guanine-nucleotide exchange factor (GEF) that acts as an activator of Rop (Rho of plants) GTPases by promoting the exchange of GDP for GTP.	Members of a novel class of Arabidopsis Rho guanine nucleotide exchange factors control Rho GTPase-dependent polar growth.2006 · DOI: 10.1105/tpc.105.036434 ROPGEF1 and ROPGEF4 are functional regulators of ROP11 GTPase in ABA-mediated stomatal closure in Arabidopsis.2012 · DOI: 10.1016/j.febslet.2012.03.040 AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022650 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009664 plant-type cell wall organization Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0048767 root hair elongation Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:2000012 regulation of auxin polar transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009531 secondary cell wall Cellular Component

GO:0016324 apical plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G01700

ath:AT2G45890

ath:AT4G00460

ath:AT4G38430

ath:AT5G02010

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.484

Rank 1 · LXL04_022650 · OH-1004

Nucleus0.308

Rank 2 · LXL04_022650 · OH-1004

Cell membrane0.198

Rank 3 · LXL04_022650 · OH-1004

Mitochondrion0.129

Rank 4 · LXL04_022650 · OH-1004

Golgi apparatus0.092

Rank 5 · LXL04_022650 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03759.19PRONE145-505 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022650	`PF03759.19`	PRONE	145	505	8.5e-163	542.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LQ89`	Arabidopsis thaliana	Rop guanine nucleotide exchange factor 2	60.085%	Swiss-Prot	strong database homology
`A4IJ27`	Arabidopsis thaliana	Rop guanine nucleotide exchange factor 3	58.491%	Swiss-Prot	strong database homology
`Q0WNP7`	Arabidopsis thaliana	Rop guanine nucleotide exchange factor 4	61.905%	Swiss-Prot	strong database homology
`Q9LZN0`	Arabidopsis thaliana	Rop guanine nucleotide exchange factor 7	57.995%	Swiss-Prot	strong database homology
`Q93ZY2`	Arabidopsis thaliana	Rop guanine nucleotide exchange factor 1	51.667%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card