LXL04_022397 | RubberDandelionOmics

Gene overview

LXL04_022397

Reference: OH-1004 Chr: Chr04 Coordinates: 149512657-149527423 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

13965 bp · LXL04_022397|LXL04_022397|OH1004|cDNA

ATGGAGGAAGAATCATTATCCAGATCACTCCTCCTGGAGGATTTTGGTCAGAAGGTGGATCTCACCAGGAGAATCAGAGAAGTTTTGTTGAATTACCCTGAAGGGATTACGGTTCTCAAGGAACTGATACAGAATGCCGACGACGCTGGCGCCACCAAAGTCTGCCTTTGCTTGGACCGTCGGTCTCACGCCACCGCCTCTCTCTTGTCCCCCAAACTCGCACAGTGGCAAGGCCCTGCTCTGTTAGCGTACAACAATGC...

CDS

Download CDS FASTA

13965 bp · LXL04_022397|LXL04_022397|OH1004|CDS

ATGGAGGAAGAATCATTATCCAGATCACTCCTCCTGGAGGATTTTGGTCAGAAGGTGGATCTCACCAGGAGAATCAGAGAAGTTTTGTTGAATTACCCTGAAGGGATTACGGTTCTCAAGGAACTGATACAGAATGCCGACGACGCTGGCGCCACCAAAGTCTGCCTTTGCTTGGACCGTCGGTCTCACGCCACCGCCTCTCTCTTGTCCCCCAAACTCGCACAGTGGCAAGGCCCTGCTCTGTTAGCGTACAACAATGC...

Protein

Download Protein FASTA

4654 aa · LXL04_022397|LXL04_022397|OH1004|PROTEIN

MEEESLSRSLLLEDFGQKVDLTRRIREVLLNYPEGITVLKELIQNADDAGATKVCLCLDRRSHATASLLSPKLAQWQGPALLAYNNAVFTEDDFASISRIGGSGKQSQAWKTGRFGVGFNSVYHLTDLPSFVSDKYVVLFDPQGDFLPNISTLNPGKRIDYVTSSAISRYQDQLSPYRAFGCNMETSFPGTIFRFPLRNESQAASSKLSKQAYLPDDISSMFEQLYEEAVFTLLFLKSVLSIEMYVWDTGMLEPKKTYSC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022397`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_022397`
Location	Chr04:149512657-149527423 (+)
Description	Similar to Sacs: Sacsin
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022397` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0090084 negative regulation of inclusion body assembly Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0030544 Hsp70 protein binding Molecular Function GO:0042802 identical protein binding Molecular Function GO:0050750 low-density lipoprotein particle receptor binding Molecular Function GO:0051087 protein-folding chaperone binding Molecular Function GO:0070628 proteasome binding Molecular Function
KEGG gene cross-reference	mmu:50720 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.634

Rank 1 · LXL04_022397 · OH-1004

Cytoplasm0.406

Rank 2 · LXL04_022397 · OH-1004

Cell membrane0.051

Rank 3 · LXL04_022397 · OH-1004

Mitochondrion0.048

Rank 4 · LXL04_022397 · OH-1004

Endoplasmic reticulum0.040

Rank 5 · LXL04_022397 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25794.2SACS19-258 aa

PF25794.2SACS1385-1621 aa

PF25794.2SACS2758-2979 aa

PF13920.13zf-C3HC4_34607-4647 aa

PF14447.13Prok-RING_44608-4649 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022397	`PF25794.2`	SACS	19	258	6.4e-199	659.0
LXL04_022397	`PF25794.2`	SACS	1385	1621	6.4e-199	659.0
LXL04_022397	`PF25794.2`	SACS	2758	2979	6.4e-199	659.0
LXL04_022397	`PF13920.13`	zf-C3HC4_3	4607	4647	3.9e-10	40.1
LXL04_022397	`PF14447.13`	Prok-RING_4	4608	4649	1.4e-06	28.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card