LXL04_018181 | RubberDandelionOmics

Gene overview

LXL04_018181

Reference: OH-1004 Chr: Chr04 Coordinates: 8137173-8140386 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1284 bp · LXL04_018181|LXL04_018181|OH1004|cDNA

ATGGCGTTCCACGACAATATCTCTCACCAAATGGCTCTTCAACACTACGCCGACCAACAACAGTTGACGGAGAACGTCGAGGTTCTCAGAGGTATATTACCGTCGGACCATCAccaacaccaccaccacctcgGCCAGTCGTCGTCCTCTCCCGACGCTGGCCCTAAGACTTCGCAGTCTCCGCCGCCTACATGGCTAAATAGCGCAATTCTCCGCCAACACAACCACCACTACGGAGGAGACGGTAGCGGCGGCAGTTT...

CDS

Download CDS FASTA

1284 bp · LXL04_018181|LXL04_018181|OH1004|CDS

ATGGCGTTCCACGACAATATCTCTCACCAAATGGCTCTTCAACACTACGCCGACCAACAACAGTTGACGGAGAACGTCGAGGTTCTCAGAGGTATATTACCGTCGGACCATCACCAACACCACCACCACCTCGGCCAGTCGTCGTCCTCTCCCGACGCTGGCCCTAAGACTTCGCAGTCTCCGCCGCCTACATGGCTAAATAGCGCAATTCTCCGCCAACACAACCACCACTACGGAGGAGACGGTAGCGGCGGCAGTTT...

Protein

Download Protein FASTA

427 aa · LXL04_018181|LXL04_018181|OH1004|PROTEIN

MAFHDNISHQMALQHYADQQQLTENVEVLRGILPSDHHQHHHHLGQSSSSPDAGPKTSQSPPPTWLNSAILRQHNHHYGGDGSGGSFLHLQTTNSDSSNSNNHWLSPRPIDNDDSNRESMFVSAINSENNLDENAMKLSQRQSESDGHGNGNGSNHERDWEFAKCKADILSHPMYDQLLSAHVSCLRIATPVDQLPRIDAQLAQSQQVIAKYSVFGNHNQPLDDKDLNQFMAHYVVLLSSFKEQLQQHVRVHAMEAVMAC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018181`
TK1151 ID	TkA08G021940
OH-1004 ID	LXL04_018181
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.900
Protein coverage (%)	TK1151 99.753 / OH-1004 99.063 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018181

Location Chr04:8137173-8140386 (+)

Description Similar to KNAT3: Homeobox protein knotted-1-like 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g25220`	Homeobox protein knotted-1-like 3.	No verified direct reference in this release
`At5g11060`	Homeobox protein knotted-1-like 4.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0292900`	Isoform 3 acts as a transcription activator, but isoforms 1 and 2 do not.	Alternative RNA products from a rice homeobox gene.1995 · DOI: 10.1046/j.1365-313x.1995.07060927.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018181 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009722 detection of cytokinin stimulus Biological Process

GO:0071345 cellular response to cytokine stimulus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT5G11060

ath:AT5G25220

dosa:Os08g0292900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.952

Rank 1 · LXL04_018181 · OH-1004

Cytoplasm0.173

Rank 2 · LXL04_018181 · OH-1004

Mitochondrion0.018

Rank 3 · LXL04_018181 · OH-1004

Cell membrane0.015

Rank 4 · LXL04_018181 · OH-1004

Endoplasmic reticulum0.008

Rank 5 · LXL04_018181 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03790.19KNOX1166-206 aa

PF03791.19KNOX2222-271 aa

PF03789.19ELK327-348 aa

PF05920.18Homeobox_KN367-406 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018181	`PF03790.19`	KNOX1	166	206	2.8e-18	66.1
LXL04_018181	`PF03791.19`	KNOX2	222	271	3.4e-15	56.0
LXL04_018181	`PF03789.19`	ELK	327	348	3.1e-07	30.8
LXL04_018181	`PF05920.18`	Homeobox_KN	367	406	4.2e-19	68.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P48000`	Arabidopsis thaliana	Homeobox protein knotted-1-like 3	59.685%	Swiss-Prot	strong database homology
`P48001`	Arabidopsis thaliana	Homeobox protein knotted-1-like 4	81.181%	Swiss-Prot	moderate database homology
`Q0J6N4`	Oryza sativa subsp. japonica	Homeobox protein knotted-1-like 13	82.129%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card