LXL04_016945 | RubberDandelionOmics

Gene overview

LXL04_016945

Reference: OH-1004 Chr: Chr03 Coordinates: 137389077-137389727 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

651 bp · LXL04_016945|LXL04_016945|OH1004|cDNA

ATGTCTCTTAGAGCTAGGCCGGTGGCAGCCGTATCTTCATCCGAGGATGACGAGAATGAAATCTCAGACGAcagtccaccaccaccaccgccgccaccaccCACCATGTCACAATGGGCAATATCACAAACCCTAGCAAGCACCGCCCAACTAGCCAACCTCCTCCCCACCGGCACCCTCCTAGCCCTCCAAACCGTAACACCAATCTTCACCAACCACGGCTCCTGCGACACCGTCACACGTCCACTCACCGCCATCCT...

CDS

Download CDS FASTA

651 bp · LXL04_016945|LXL04_016945|OH1004|CDS

ATGTCTCTTAGAGCTAGGCCGGTGGCAGCCGTATCTTCATCCGAGGATGACGAGAATGAAATCTCAGACGACAGTCCACCACCACCACCGCCGCCACCACCCACCATGTCACAATGGGCAATATCACAAACCCTAGCAAGCACCGCCCAACTAGCCAACCTCCTCCCCACCGGCACCCTCCTAGCCCTCCAAACCGTAACACCAATCTTCACCAACCACGGCTCCTGCGACACCGTCACACGTCCACTCACCGCCATCCT...

Protein

Download Protein FASTA

216 aa · LXL04_016945|LXL04_016945|OH1004|PROTEIN

MSLRARPVAAVSSSEDDENEISDDSPPPPPPPPPTMSQWAISQTLASTAQLANLLPTGTLLALQTVTPIFTNHGSCDTVTRPLTAILLIFLTAACFLASFTDSFKSSTGQVFYGFATFKGMWLFDYQTAAADPSGLPDLRKYRLTAVDWIHAFVSAFVLMTLASRDRSVVSCFYPRPSHEVEEVLNIVPLGIGLGCSLVFVIFPSKRHGIGYPVSH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016945`
TK1151 ID	TkA02G091110
OH-1004 ID	LXL04_016945
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 97.222 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016945

Location Chr03:137389077-137389727 (+)

Description Similar to DMP5: Protein DMP5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02430`	Involved in membrane remodeling.	No verified direct reference in this release
`At4g24310`	Involved in membrane remodeling.	No verified direct reference in this release
`At5g46090`	Involved in membrane remodeling.	No verified direct reference in this release
`At4g18425`	Involved in membrane remodeling.	No verified direct reference in this release
`At4g28485`	Involved in membrane remodeling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016945 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009838 abscission Biological Process

GO:0009900 dehiscence Biological Process

GO:0010256 endomembrane system organization Biological Process

GO:0090693 plant organ senescence Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

KEGG gene cross-reference

ath:AT3G02430

ath:AT4G18425

ath:AT4G24310

ath:AT4G28485

ath:AT5G46090

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.366

Rank 1 · LXL04_016945 · OH-1004

Lysosome / Vacuole0.303

Rank 2 · LXL04_016945 · OH-1004

Cell membrane0.219

Rank 3 · LXL04_016945 · OH-1004

Cytoplasm0.159

Rank 4 · LXL04_016945 · OH-1004

Golgi apparatus0.150

Rank 5 · LXL04_016945 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05078.18DUF67947-212 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016945	`PF05078.18`	DUF679	47	212	3.2e-63	213.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M897`	Arabidopsis thaliana	Protein DMP5	53.731%	Swiss-Prot	strong database homology
`Q9STW3`	Arabidopsis thaliana	Protein DMP3	56.667%	Swiss-Prot	strong database homology
`Q9FNL3`	Arabidopsis thaliana	Protein DMP6	46.000%	Swiss-Prot	moderate database homology
`Q8L928`	Arabidopsis thaliana	Protein DMP4	40.465%	Swiss-Prot	moderate database homology
`Q5XV67`	Arabidopsis thaliana	Protein DMP7	37.306%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card