LXL04_013873 | RubberDandelionOmics

Gene overview

LXL04_013873

Reference: OH-1004 Chr: Chr03 Coordinates: 37255848-37260243 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2364 bp · LXL04_013873|LXL04_013873|OH1004|cDNA

ATGGAATTGAGTTTTCACATTCCAAACCTACACGATATGTCAGAAGTGGAGAATCAAGATACTGGAAATCCAAAAGAGGAGACCATTTCATCAAACGATAACCTCGATTCAAATGACACTCAAGATGAGTTGATGCAAACAGTAGCAGATCTCAAGTTTCAAAATGAGTACTTGAAGTCTCACTTCCATGACTTAAAGAACCTATACACAGATTCAGCTTCTTCCATCCAACAAACACAAGCAATTGATCAAGAGAAGGC...

CDS

Download CDS FASTA

2364 bp · LXL04_013873|LXL04_013873|OH1004|CDS

ATGGAATTGAGTTTTCACATTCCAAACCTACACGATATGTCAGAAGTGGAGAATCAAGATACTGGAAATCCAAAAGAGGAGACCATTTCATCAAACGATAACCTCGATTCAAATGACACTCAAGATGAGTTGATGCAAACAGTAGCAGATCTCAAGTTTCAAAATGAGTACTTGAAGTCTCACTTCCATGACTTAAAGAACCTATACACAGATTCAGCTTCTTCCATCCAACAAACACAAGCAATTGATCAAGAGAAGGC...

Protein

Download Protein FASTA

787 aa · LXL04_013873|LXL04_013873|OH1004|PROTEIN

MELSFHIPNLHDMSEVENQDTGNPKEETISSNDNLDSNDTQDELMQTVADLKFQNEYLKSHFHDLKNLYTDSASSIQQTQAIDQEKAHEDSKELHDKIDSLNKELLEERQTRAAAEAALEHLRIEYSEADAKSQDLAAKLAEAEKNLEQQIKERDEKNSELDSKLNRLHKRAKQRIQEVQKEKDDIEAKFKEVNEKSEQTSSQLSALQQELERTRQHANEALKAIDVERQQLRSANNRLRDNIEELRRSLEPKENTIETL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013873`
TK1151 ID	TkA02G466840
OH-1004 ID	LXL04_013873
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 99.596 / OH-1004 93.901 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013873

Location Chr03:37255848-37260243 (-)

Description Similar to GRIP: Protein GRIP

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66030`	Golgi matrix protein playing a role in tethering of vesicles to Golgi membranes and in maintaining the overall structure of the Golgi apparatus.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013873 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0007098 centrosome cycle Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0007155 cell adhesion Biological Process

GO:0009888 tissue development Biological Process

GO:0030334 regulation of cell migration Biological Process

GO:0045785 positive regulation of cell adhesion Biological Process

GO:0045995 regulation of embryonic development Biological Process

GO:0048193 Golgi vesicle transport Biological Process

GO:0051642 centrosome localization Biological Process

GO:0110011 regulation of basement membrane organization Biological Process

GO:2001046 positive regulation of integrin-mediated signaling pathway Biological Process

KEGG gene cross-reference

ath:AT5G66030

ddi:DDB_G0289429

mmu:16773

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.522

Rank 1 · LXL04_013873 · OH-1004

Cytoplasm0.480

Rank 2 · LXL04_013873 · OH-1004

Nucleus0.136

Rank 3 · LXL04_013873 · OH-1004

Endoplasmic reticulum0.121

Rank 4 · LXL04_013873 · OH-1004

Cell membrane0.060

Rank 5 · LXL04_013873 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01465.26GRIP714-753 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013873	`PF01465.26`	GRIP	714	753	1.5e-12	47.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S2T0`	Arabidopsis thaliana	Protein GRIP	59.067%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card