LXL04_010222 | RubberDandelionOmics

Gene overview

LXL04_010222

Reference: OH-1004 Chr: Chr02 Coordinates: 142401859-142405455 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2213 bp · LXL04_010222|LXL04_010222|OH1004|cDNA

ATGGGGTCGTTTCAAGCATACGAAAGTTACGATTACATGTTCAAAGTTGTTATGATTGGGGATTCAGGTGTCGGTAAAACCAATCTTTTGTCCCGATTCTCCAAGAACGAATTTCGCCTGGAATACAGAGCCACAATCGGAGTTGAATTCGGCAACCGTAGCATCAACGTTGATGGTAAGATCATCATGGCCCAAATTTGGGATACCGCCGGTAATCAAAGGTATCCAGCTATACCTTCCCCATACTATCGTGGAGCAGC...

CDS

Download CDS FASTA

2193 bp · LXL04_010222|LXL04_010222|OH1004|CDS

ATGGGGTCGTTTCAAGCATACGAAAGTTACGATTACATGTTCAAAGTTGTTATGATTGGGGATTCAGGTGTCGGTAAAACCAATCTTTTGTCCCGATTCTCCAAGAACGAATTTCGCCTGGAATACAGAGCCACAATCGGAGTTGAATTCGGCAACCGTAGCATCAACGTTGATGGTAAGATCATCATGGCCCAAATTTGGGATACCGCCGGTAATCAAAGGTATCCAGCTATACCTTCCCCATACTATCGTGGAGCAGC...

Protein

Download Protein FASTA

730 aa · LXL04_010222|LXL04_010222|OH1004|PROTEIN

MGSFQAYESYDYMFKVVMIGDSGVGKTNLLSRFSKNEFRLEYRATIGVEFGNRSINVDGKIIMAQIWDTAGNQRYPAIPSPYYRGAAGALIVYDITRPETFKNVEKWLKELRDVTDNDIVVMLVGNKTDQNNLRSIRTKDAKAFAHRKNINLFMETSALNMSNVMNAFTKVVTQIKHMMCKKMADVKKVNDQMAMVEPKGQTITGGGGEDITRIPRETDCVMESRRYSQNSDPITETTPKSTRYSQDNNGSITDPPRLSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010222`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010222

Location Chr02:142401859-142405455 (+)

Description Similar to CBSX5: CBS domain-containing protein CBSX5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27460`	CBS domain-containing protein CBSX5.	No verified direct reference in this release
`At5g60860`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At3g15060`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At4g18430`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010222 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005768 endosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

KEGG gene cross-reference

ath:AT3G15060

ath:AT4G18430

ath:AT4G27460

ath:AT5G60860

nta:107770722

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.416

Rank 1 · LXL04_010222 · OH-1004

Nucleus0.343

Rank 2 · LXL04_010222 · OH-1004

Cell membrane0.154

Rank 3 · LXL04_010222 · OH-1004

Lysosome / Vacuole0.082

Rank 4 · LXL04_010222 · OH-1004

Golgi apparatus0.069

Rank 5 · LXL04_010222 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00025.28Arf7-173 aa

PF00071.29Ras15-176 aa

PF08477.20Roc15-129 aa

PF14223.15Retrotran_gag_2309-351 aa

PF00571.34CBS674-711 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010222	`PF00025.28`	Arf	7	173	4.9e-09	36.6
LXL04_010222	`PF00071.29`	Ras	15	176	9.8e-56	188.5
LXL04_010222	`PF08477.20`	Roc	15	129	2e-31	109.4
LXL04_010222	`PF14223.15`	Retrotran_gag_2	309	351	7.1e-06	26.6
LXL04_010222	`PF00571.34`	CBS	674	711	5.3e-09	37.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WQ5`	Arabidopsis thaliana	CBS domain-containing protein CBSX5	46.292%	Swiss-Prot	moderate database homology
`Q9FJH0`	Arabidopsis thaliana	Ras-related protein RABA1f	58.636%	Swiss-Prot	weak database homology
`Q9LK99`	Arabidopsis thaliana	Ras-related protein RABA1g	57.273%	Swiss-Prot	weak database homology
`O49513`	Arabidopsis thaliana	Ras-related protein RABA1e	57.273%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card