LXL04_009750 | RubberDandelionOmics

Gene overview

LXL04_009750

Reference: OH-1004 Chr: Chr02 Coordinates: 132574047-132586758 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1260 bp · LXL04_009750|LXL04_009750|OH1004|cDNA

ATGGAAGCAACGACTGATCATGAGAAAGCGACACCCACAAAGCTTGAGGGGAAGTTTACGGCAATGGTGGTTTGTTGGCTTCTTGGAATTGGGTGTTTGTTTTCTTGGAATAGCATGCTCACGGTACAAGATTACTATGTTACTTTGTTCCCGAATTATCACCCATCAAGAATTCTAACGCTCGTATACCAACCATTCGCTCTTGGAACACTCGCGATACTTACATACTATGAAGCGACTATAAATACAAGGAGACGAAA...

CDS

Download CDS FASTA

1260 bp · LXL04_009750|LXL04_009750|OH1004|CDS

ATGGAAGCAACGACTGATCATGAGAAAGCGACACCCACAAAGCTTGAGGGGAAGTTTACGGCAATGGTGGTTTGTTGGCTTCTTGGAATTGGGTGTTTGTTTTCTTGGAATAGCATGCTCACGGTACAAGATTACTATGTTACTTTGTTCCCGAATTATCACCCATCAAGAATTCTAACGCTCGTATACCAACCATTCGCTCTTGGAACACTCGCGATACTTACATACTATGAAGCGACTATAAATACAAGGAGACGAAA...

Protein

Download Protein FASTA

419 aa · LXL04_009750|LXL04_009750|OH1004|PROTEIN

MEATTDHEKATPTKLEGKFTAMVVCWLLGIGCLFSWNSMLTVQDYYVTLFPNYHPSRILTLVYQPFALGTLAILTYYEATINTRRRNLFGYILFFFSTLAVLILDLATSGKGGIGSFIGVCAISGAFGVADAYAQGGMIGDLSFMLPEFIQSFVAGLAASGAITSGLRMVTKGVFDNSQNGLRKGALLFFALCTIFELLCVLLYAFVFPKLPIVKYYRSKAASEGSKTVSADLAAGGIYSQSGEEDTNSTKQERLSNKEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009750`
TK1151 ID	TkA03G468370
OH-1004 ID	LXL04_009750
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 99.740 / OH-1004 91.647 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009750

Location Chr02:132574047-132586758 (+)

Description Similar to ENT3: Equilibrative nucleotide transporter 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g05120`	Nucleoside transporter that functions as a pyrimidine nucleoside carrier in all organs.	Equilibrative nucleoside transporters of Arabidopsis thaliana. cDNA cloning, expression pattern, and analysis of transport activities.2003 · DOI: 10.1074/jbc.m304768200 Characterization of three novel members of the Arabidopsis thaliana equilibrative nucleoside transporter (ENT) family.2004 · DOI: 10.1042/bj20040389 The fluorouridine insensitive 1 (fur1) mutant is defective in equilibrative nucleoside transporter 3 (ENT3), and thus represents an important pyrimidine nucleoside uptake system in Arabidopsis thaliana.2007 · DOI: 10.1111/j.1365-313x.2006.02998.x Nucleoside transport across the plasma membrane mediated by equilibrative nucleoside transporter 3 influences metabolism of Arabidopsis seedlings.2012 · DOI: 10.1111/j.1438-8677.2012.00562.x
`At4g05110`	Nucleoside transporter that can mediate uptake of adenosine, uridine, guanosine or cytidine when expressed in a heterologous system (yeast).	Characterization of three novel members of the Arabidopsis thaliana equilibrative nucleoside transporter (ENT) family.2004 · DOI: 10.1042/bj20040389
`At4g05140`	May be involved in nucleoside transport.	No verified direct reference in this release
`At3g09990`	May be involved in nucleoside transport.	No verified direct reference in this release
`At4g05130`	Nucleoside transporter that can mediate uptake of adenosine, uridine, guanosine or cytidine when expressed in a heterologous system (yeast).	Characterization of three novel members of the Arabidopsis thaliana equilibrative nucleoside transporter (ENT) family.2004 · DOI: 10.1042/bj20040389

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009750 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015858 nucleoside transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005337 nucleoside transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G09990

ath:AT4G05110

ath:AT4G05120

ath:AT4G05130

ath:AT4G05140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.585

Rank 1 · LXL04_009750 · OH-1004

Lysosome / Vacuole0.218

Rank 2 · LXL04_009750 · OH-1004

Endoplasmic reticulum0.107

Rank 3 · LXL04_009750 · OH-1004

Cytoplasm0.082

Rank 4 · LXL04_009750 · OH-1004

Golgi apparatus0.056

Rank 5 · LXL04_009750 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01733.25Nucleoside_tran128-413 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009750	`PF01733.25`	Nucleoside_tran	128	413	7.1e-33	115.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M0Y3`	Arabidopsis thaliana	Equilibrative nucleotide transporter 3	68.370%	Swiss-Prot	strong database homology
`Q944N8`	Arabidopsis thaliana	Equilibrative nucleotide transporter 6	64.234%	Swiss-Prot	strong database homology
`Q9M0Y1`	Arabidopsis thaliana	Equilibrative nucleotide transporter 5	64.634%	Swiss-Prot	strong database homology
`Q9SR64`	Arabidopsis thaliana	Equilibrative nucleotide transporter 2	64.234%	Swiss-Prot	strong database homology
`Q9M0Y2`	Arabidopsis thaliana	Equilibrative nucleotide transporter 4	61.501%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card