LXL04_007353 | RubberDandelionOmics

Gene overview

LXL04_007353

Reference: OH-1004 Chr: Chr02 Coordinates: 45341192-45343058 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1089 bp · LXL04_007353|LXL04_007353|OH1004|cDNA

ATGGCTACTGCAACACAAAAGGTTTTGCTGTTTGTGATATATGCGGCCATTAATGGTGTAGTGATTATGACAGATAGTGCGCCCATATTTGTATTTGGGGATTCAACTGCAGATGTTGGGACAAATAATCACCTTCAAAACTGCACCGCCAGGGCTGATCACCGTTACAATGGAATCGATTTTCCATTTTCTAGAACAACCGGAAGGTTCAGTAATGGAAAAAACGCTGCTGATCAAATTGCAAGGCTGTTGGGGGATTA...

CDS

Download CDS FASTA

1089 bp · LXL04_007353|LXL04_007353|OH1004|CDS

ATGGCTACTGCAACACAAAAGGTTTTGCTGTTTGTGATATATGCGGCCATTAATGGTGTAGTGATTATGACAGATAGTGCGCCCATATTTGTATTTGGGGATTCAACTGCAGATGTTGGGACAAATAATCACCTTCAAAACTGCACCGCCAGGGCTGATCACCGTTACAATGGAATCGATTTTCCATTTTCTAGAACAACCGGAAGGTTCAGTAATGGAAAAAACGCTGCTGATCAAATTGCAAGGCTGTTGGGGGATTA...

Protein

Download Protein FASTA

362 aa · LXL04_007353|LXL04_007353|OH1004|PROTEIN

MATATQKVLLFVIYAAINGVVIMTDSAPIFVFGDSTADVGTNNHLQNCTARADHRYNGIDFPFSRTTGRFSNGKNAADQIARLLGDYKVSPPPFFSLLTRKSTFKRNLLRGANFASGGSGILSETGQVTFNKVICLGEQIQQFSTVRRRITKLLASTKAADDLLQNSIYIISIGSNDLVESLFSGQPGGPKKFIQKLTETYVTHLTNLYELGARKFGIIGIPPIGCCPAARVFNSTGCYEELNYNARLFYGSMQSLLTEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007353`
TK1151 ID	TkA03G162020
OH-1004 ID	LXL04_007353
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007353

Location Chr02:45341192-45343058 (-)

Description Similar to At5g33370: GDSL esterase/lipase At5g33370

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g33370`	GDSL esterase/lipase At5g33370.	No verified direct reference in this release
`At5g37690`	GDSL esterase/lipase At5g37690.	No verified direct reference in this release
`At4g28780`	GDSL esterase/lipase At4g28780.	No verified direct reference in this release
`At5g18430`	GDSL esterase/lipase At5g18430.	No verified direct reference in this release
`At3g04290`	Involved in the mechanisms of salt tolerance.	Overexpression of Arabidopsis thaliana LTL1, a salt-induced gene encoding a GDSL-motif lipase, increases salt tolerance in yeast and transgenic plants.2006 · DOI: 10.1111/j.1365-3040.2006.01565.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007353 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009751 response to salicylic acid Biological Process

GO:0010226 response to lithium ion Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:0160062 cutin-based cuticle development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016788 hydrolase activity, acting on ester bonds Molecular Function

KEGG gene cross-reference

ath:AT3G04290

ath:AT4G28780

ath:AT5G18430

ath:AT5G33370

ath:AT5G37690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.449

Rank 1 · LXL04_007353 · OH-1004

Lysosome / Vacuole0.126

Rank 2 · LXL04_007353 · OH-1004

Cell membrane0.125

Rank 3 · LXL04_007353 · OH-1004

Endoplasmic reticulum0.122

Rank 4 · LXL04_007353 · OH-1004

Cytoplasm0.094

Rank 5 · LXL04_007353 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00657.29Lipase_GDSL29-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007353	`PF00657.29`	Lipase_GDSL	29	339	2.3e-34	120.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LB81`	Arabidopsis thaliana	GDSL esterase/lipase At5g33370	37.057%	Swiss-Prot	moderate database homology
`Q9FHQ1`	Arabidopsis thaliana	GDSL esterase/lipase At5g37690	37.888%	Swiss-Prot	moderate database homology
`Q9SVU5`	Arabidopsis thaliana	GDSL esterase/lipase At4g28780	37.353%	Swiss-Prot	moderate database homology
`Q5PNZ0`	Arabidopsis thaliana	GDSL esterase/lipase At5g18430	35.870%	Swiss-Prot	moderate database homology
`Q9M8Y5`	Arabidopsis thaliana	GDSL esterase/lipase LTL1	37.135%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card