LXL04_006688 | RubberDandelionOmics

Gene overview

LXL04_006688

Reference: OH-1004 Chr: Chr02 Coordinates: 22320707-22325119 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1071 bp · LXL04_006688|LXL04_006688|OH1004|cDNA

ATGATTGCTAGAACTACTCCGAAATCGCTATccagattcttcttgctttCGCGACACCTCTGCACGGCTACCGGAACTCAAACGCAGAAGCTCGAAAGAATCGCCGACGAGATCCTTAGCCTTACGAAACTCGAGAGGAATGACTACGCAGTCCTCCTACGGTACAAGATGGGTTTCAACAACTACGGTCCCGCAGTGACCGGCATTGGTTCGCCGTCAGTCGGTGGGGCTGCCGCTGCTGGACCAGGATCCGATGCCAA...

CDS

Download CDS FASTA

1071 bp · LXL04_006688|LXL04_006688|OH1004|CDS

ATGATTGCTAGAACTACTCCGAAATCGCTATCCAGATTCTTCTTGCTTTCGCGACACCTCTGCACGGCTACCGGAACTCAAACGCAGAAGCTCGAAAGAATCGCCGACGAGATCCTTAGCCTTACGAAACTCGAGAGGAATGACTACGCAGTCCTCCTACGGTACAAGATGGGTTTCAACAACTACGGTCCCGCAGTGACCGGCATTGGTTCGCCGTCAGTCGGTGGGGCTGCCGCTGCTGGACCAGGATCCGATGCCAA...

Protein

Download Protein FASTA

356 aa · LXL04_006688|LXL04_006688|OH1004|PROTEIN

MIARTTPKSLSRFFLLSRHLCTATGTQTQKLERIADEILSLTKLERNDYAVLLRYKMGFNNYGPAVTGIGSPSVGGAAAAGPGSDAKAAEKVVFDVKLEKYDAATKIKIIKEVRAFTDLGLKEAKDLVEKVPVVVKKGITKDDAEAIMAKLKDLGATVVKLWMLRSRCRTSKLAQLIGSQSSTAHRFVFPQLISRFSTDALSVEYKAGEIGTVSGIPDEHLQRRVLIYSPARTASQQGAGKVGKWKINFMSTQKWENPLM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006688`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006688

Location Chr02:22320707-22325119 (-)

Description Similar to FRO1: NADH dehydrogenase [ubiquinone] iron-sulfur protein 4, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67590`	Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006688 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001932 regulation of protein phosphorylation Biological Process

GO:0006120 mitochondrial electron transport, NADH to ubiquinone Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009631 cold acclimation Biological Process

GO:0022904 respiratory electron transport chain Biological Process

GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process

GO:0042776 proton motive force-driven mitochondrial ATP synthesis Biological Process

GO:0051591 response to cAMP Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT5G67590

ggo:101125075

hsa:4724

pon:100172316

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.938

Rank 1 · LXL04_006688 · OH-1004

Cytoplasm0.062

Rank 2 · LXL04_006688 · OH-1004

Nucleus0.046

Rank 3 · LXL04_006688 · OH-1004

Plastid0.020

Rank 4 · LXL04_006688 · OH-1004

Cell membrane0.018

Rank 5 · LXL04_006688 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00542.25Ribosomal_L1294-158 aa

PF04800.18NDUS4225-297 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006688	`PF00542.25`	Ribosomal_L12	94	158	9.4e-23	81.0
LXL04_006688	`PF04800.18`	NDUS4	225	297	2.5e-25	89.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJW4`	Arabidopsis thaliana	NADH dehydrogenase [ubiquinone] iron-sulfur protein 4, mitochondrial	62.025%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card