LXL04_000947 | RubberDandelionOmics

Gene overview

LXL04_000947

Reference: OH-1004 Chr: Chr01 Coordinates: 17073224-17074813 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1590 bp · LXL04_000947|LXL04_000947|OH1004|cDNA

ATGGCATCAAATGGCAATTTACAAGTTCTTAATGCACTTGACGGAGCAAAAACTCAATGGTACCATTTTACTGCAATCATAATCGCCGGAATGGGGTTCTTCACAGATGCTTACGACCTTTTCTGCATCTCCTTGGTGACGAAGATGCTTGGGCGGATTTACTACCACAAACCAGGCTCTTTGAAGCCGGGAAGTTTACCTCCGGATGTGTCTGCCGCCGTGAACGGTGTTGCCCTCGTCGGAACCCTAGCCGGGCAACT...

CDS

Download CDS FASTA

1590 bp · LXL04_000947|LXL04_000947|OH1004|CDS

ATGGCATCAAATGGCAATTTACAAGTTCTTAATGCACTTGACGGAGCAAAAACTCAATGGTACCATTTTACTGCAATCATAATCGCCGGAATGGGGTTCTTCACAGATGCTTACGACCTTTTCTGCATCTCCTTGGTGACGAAGATGCTTGGGCGGATTTACTACCACAAACCAGGCTCTTTGAAGCCGGGAAGTTTACCTCCGGATGTGTCTGCCGCCGTGAACGGTGTTGCCCTCGTCGGAACCCTAGCCGGGCAACT...

Protein

Download Protein FASTA

529 aa · LXL04_000947|LXL04_000947|OH1004|PROTEIN

MASNGNLQVLNALDGAKTQWYHFTAIIIAGMGFFTDAYDLFCISLVTKMLGRIYYHKPGSLKPGSLPPDVSAAVNGVALVGTLAGQLFFGWLGDKLGRKKVYGITLMLMCLCSIASGLSFGSNPKMVMATLCFFRFWLGFGIGGDYPLSATIMSEYSNKKTRGGFIAAVFAMQGFGILGGGVFAIILSSVFDSKFKAPAYEVDPIGSTVPEADYVWRIILMVGALPALLTYYWRLKMPETARYTALVAKNANQAAMDMSK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000947`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000947

Location Chr01:17073224-17074813 (-)

Description Similar to PHT1-4: Inorganic phosphate transporter 1-4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38940`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release
`At3g54700`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release
`At5g43350`	High-affinity transporter for external inorganic phosphate.	Phosphate transport in Arabidopsis: Pht1;1 and Pht1;4 play a major role in phosphate acquisition from both low- and high-phosphate environments.2004 · DOI: 10.1111/j.1365-313x.2004.02161.x Overexpression of an Arabidopsis thaliana high-affinity phosphate transporter gene in tobacco cultured cells enhances cell growth under phosphate-limited conditions.1997 · DOI: 10.1073/pnas.94.13.7098
`At5g43360`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000947 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006817 phosphate ion transport Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0080187 floral organ senescence Biological Process

GO:1901684 arsenate ion transmembrane transport Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G38940

ath:AT3G54700

ath:AT5G43350

ath:AT5G43360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.566

Rank 1 · LXL04_000947 · OH-1004

Cytoplasm0.157

Rank 2 · LXL04_000947 · OH-1004

Lysosome / Vacuole0.153

Rank 3 · LXL04_000947 · OH-1004

Endoplasmic reticulum0.105

Rank 4 · LXL04_000947 · OH-1004

Golgi apparatus0.081

Rank 5 · LXL04_000947 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083.31Sugar_tr27-516 aa

PF07690.22MFS_168-458 aa

PF07690.22MFS_1366-511 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000947	`PF00083.31`	Sugar_tr	27	516	3.7e-51	175.1
LXL04_000947	`PF07690.22`	MFS_1	68	458	7.8e-27	94.8
LXL04_000947	`PF07690.22`	MFS_1	366	511	7.8e-27	94.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q96303`	Arabidopsis thaliana	Inorganic phosphate transporter 1-4	80.469%	Swiss-Prot	strong database homology
`Q494P0`	Arabidopsis thaliana	Probable inorganic phosphate transporter 1-7	80.464%	Swiss-Prot	strong database homology
`Q8VYM2`	Arabidopsis thaliana	Inorganic phosphate transporter 1-1	78.835%	Swiss-Prot	strong database homology
`O48639`	Arabidopsis thaliana	Probable inorganic phosphate transporter 1-3	77.885%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card