Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1374 bp · LXL04_000483|LXL04_000483|OH1004|cDNA
ATGGCAACATCAACATGTACATCGCCATTGTCAATGCCACTAGAAACTCAAGATTCAATCAGAGTACCCACAGTTACCGGATTAAGACTTTCAACATCAAAGATAACCACTCACGGGAAACACACCACCATTTCTTCACATCCACCCAAGATAACATGCTCATCAATCAACAAATTCAACAACAAAGATTCATTTCTAAACTCACACCCCGAAGTCTATCTACTCAGAGGTGAAGGAAACAACACAGTGATAACTCCAGG...
1374 bp · LXL04_000483|LXL04_000483|OH1004|CDS
ATGGCAACATCAACATGTACATCGCCATTGTCAATGCCACTAGAAACTCAAGATTCAATCAGAGTACCCACAGTTACCGGATTAAGACTTTCAACATCAAAGATAACCACTCACGGGAAACACACCACCATTTCTTCACATCCACCCAAGATAACATGCTCATCAATCAACAAATTCAACAACAAAGATTCATTTCTAAACTCACACCCCGAAGTCTATCTACTCAGAGGTGAAGGAAACAACACAGTGATAACTCCAGG...
Protein
Download Protein FASTA457 aa · LXL04_000483|LXL04_000483|OH1004|PROTEIN
MATSTCTSPLSMPLETQDSIRVPTVTGLRLSTSKITTHGKHTTISSHPPKITCSSINKFNNKDSFLNSHPEVYLLRGEGNNTVITPGQESIRNPTISTNYNEAKIKVIGVGGGGSNAVNRMIENAMKGVEFYIVNTDVQALKMSPVFPNHRLQIGQELTRGLGAGGNPDVGMNAAKESRESIEEALNGSDMVFVTAGMGGGTGTGAGPIIAGVAKSMGILTVGIVTTPFSFEGRRRAVQAQEGIALLRENVDTLIVIPND...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_000483 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_000483 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:8805424-8807283 (-) | |||||||||
| Description | Similar to FTSZ2-2: Cell division protein FtsZ homolog 2-2, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009612 response to mechanical stimulus Biological Process GO:0009658 chloroplast organization Biological Process GO:0009739 response to gibberellin Biological Process GO:0010020 chloroplast fission Biological Process GO:0032506 cytokinetic process Biological Process GO:0043093 FtsZ-dependent cytokinesis Biological Process GO:0051258 protein polymerization Biological Process GO:0051301 cell division Biological Process GO:0005737 cytoplasm Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component | |||||||||
| KEGG gene cross-reference | ana:alr3858 ath:AT2G36250 ath:AT3G52750 bha:BH2558 syn:sll1633 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00091.32Tubulin104-265 aaPF12327.14FtsZ_C315-409 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_000483 | PF00091.32 | Tubulin | 104 | 265 | 4.9e-48 | 164.7 |
| LXL04_000483 | PF12327.14 | FtsZ_C | 315 | 409 | 8.7e-31 | 106.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.